Лада 4 х 4 2019 года новая модель: новые подробности и дата выхода — Российская газета

Содержание

LADA новости | Лада-Центр – официальный дилер LADA в Санкт-Петербурге

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю АО «АВТОВАЗ», а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

FAVORIT MOTORS — крупнейший автомобильный холдинг Москвы

Техническое обслуживание

Регулярное ТО гарантирует исправность и безопасность Вашей машины. По регламенту большинства автопроизводителей (Audi, BMW, Dodge, Mercedes, Nissan, Seat и других) проходить техобслуживание необходимо каждые 15–20 тысяч километров пробега (1 раз в год). В рамках ТО специалисты сертифицированного сервисного центра FAVORIT MOTORS проводят диагностику, которая позволяет выявить любые неисправности.

Узнать стоимость

Слесарный ремонт

Слесарный ремонт направлен на устранение дефектов систем и механизмов машины – мотора, рулевого управления, тормозов, ходовой части и других. Также он включает развал-схождение и шиномонтаж. Профессиональное оборудование позволяет опытным мастерам техцентров быстро и качественно решать сложные задачи.

Кузовной ремонт

Ремонт кузова позволяет восстановить его геометрию, устранить вмятины, трещины на элементах авто, дефекты лакокрасочного покрытия. Для решения подобных задач аттестованные производителем мастера используют специальные компьютерные программы, стапельные станки.

Диагностика

Диагностика автомобиля направлена на выявление дефектов в функционировании ключевых систем и механизмов – мотора, трансмиссии, электрики, оптики и других. Она проводится с помощью профессионального оборудования, что позволяет получить точный результат. Это обязательный этап при выполнении техобслуживания и ремонта машины.

Шиномонтаж

Шиномонтаж включает следующие операции:

  • Демонтаж, монтаж покрышек.
  • Установку колес, их подкачку.
  • Ремонт шин.
  • Балансировку колес.
  • Сезонную замену резины.

Качественно выполненные работы гарантируют безопасность передвижения и долговечность ходовой части машины.

LADA 4×4 Urban 3 дв. – Руководство по эксплуатации – Первый Лада Центр, Краснодар.

Отправляя сообщение, я соглашаюсь с политикой обработки персональных данных, выражаю свое согласие и разрешаю Первый Лада Центр (ООО «Центр-Моторс»), а также, по их поручению, третьим лицам осуществлять обработку моих персональных данных (фамилия, имя, отчество, год, месяц, дата и место рождения; адрес, номер паспорта и сведения о дате выдачи паспорта и выдавшем его органе; образование, профессия, место работы и должность; домашний, рабочий и мобильный телефоны; адрес электронной почты и другие данные, требуемые для отправки сообщения), включая сбор, систематизацию, накопление, хранение, уточнение, использование, распространение (в том числе трансграничную передачу), обезличивание, уничтожение персональных данных), в целях связанных с возможностью предоставления информации о товарах и услугах, которые потенциально могут представлять интерес, а также в целях сбора и обработки статистической информации и проведения маркетинговых исследований. Согласие на обработку персональных данных в соответствии с указанными выше условиями я предоставляю на 10 (десять) лет. Я уведомлен и согласен с тем, что указанное согласие может быть мной отозвано посредством направления письменного заявления заказным почтовым отправлением с описью вложения, либо вручено лично под подпись.

Циклические биосенсоры GMP на основе FRET измеряют низкие концентрации цГМФ в кардиомиоцитах и ​​нейронах

Фиг.3

Yellow Pf Биосенсор PKG контролирует цГМФ из GC-A и GC-B в кардиомиоцитах. а…

Рис. 3

Yellow Pf Биосенсор PKG контролирует цГМФ из GC-A и GC-B в кардиомиоцитах. a Конфокальные изображения живого кардиомиоцита, экспрессирующего биосенсор Yellow Pf PKG. Шкала шкалы: 10 мкм. b , c , e , f Регистрация соотношения FRET (CFP / Venus) в отдельных кардиомиоцитах, экспрессирующих биосенсор PKG Yellow Pf и стимулированных донорским NO SNAP (100 мкМ), ингибитором PDE IBMX (100 мкМ), ингибитор sGC ODQ (10 мкМ), BNP (300 нМ) или CNP (300 нМ), если указано. Сигнал FRET был нормализован по отношению к сигналу во время стимуляции.Показаны следы, представляющие шесть клеток от четырех животных (SNAP), восьми клеток от четырех животных (ODQ), пяти клеток от четырех животных (BNP) или шести клеток от шести животных (CNP). d

Общие уровни цГМФ в изолированных кардиомиоцитах желудочка в отсутствие (Ctr) или в присутствии 50 нМ SNAP, 100 мкМ SNAP или 300 нМ CNP (10-минутная стимуляция). Данные представляют собой среднее значение ± стандартная ошибка среднего из пяти отдельных экспериментов. г Регистрация соотношения FRET (Т-сапфир / димер2) в отдельных кардиомиоцитах, экспрессирующих красный биосенсор cGES-DE5 и стимулированных CNP (300 нМ) и IBMX (100 мкМ) (где указано).FRET был нормализован до значения до стимуляции. Показаны кривые, представляющие четыре клетки от четырех животных. ч Регистрация соотношения FRET (CFP / Venus) в одиночных кардиомиоцитах, экспрессирующих биосенсор PKG Yellow Pf , стимулированный возрастающими концентрациями CNP. Показаны кривые, репрезентативные для девяти отдельных клеток от пяти животных, нормализованные к таковым до стимуляции. i Кривые «концентрация-ответ», полученные при стимуляции повышающимися концентрациями CNP в отдельных кардиомиоцитах, экспрессирующих указанный биосенсор.Данные представлены в виде центилей, а для EC
50
указано среднее значение ± SEM (девять клеток от пяти животных для Yellow Pf PKG, шесть клеток от шести животных для Red cGES-DE5). p = 0,37 (непарный t-критерий). j Количественная оценка ответов FRET, показанных на b, c и e – g. p = 0,006 для CNP-стимуляции для Pf PKG по сравнению с красным cGES-DE5 (односторонний дисперсионный анализ с тестом множественных сравнений Сидака). k Максимальный ответ FRET (CNP + IBMX) кардиомиоцитов, экспрессирующих указанный биосенсор.Данные представляют собой среднее значение ± стандартная ошибка среднего для 34 клеток от 27 животных (желтый Pf PKG) и 16 клеток от 10 животных (красный cGES-DE5). * p = 0,0001 по сравнению с красным cGES-DE5 (двусторонний тест Студента t )

PET и FRET полезность пары аминокислот: триптофан и 4-цианотриптофан

Методы, основанные на флуоресцентном резонансном переносе энергии (FRET) и фотоиндуцированном переносе электронов (PET), широко используются в биологических науках, в основном с использованием пар FRET и PET на основе красителей.Будучи очень полезными и важными, репортеры на основе красителей не всегда можно без проблем применять, например, в случаях, когда необходимо минимизировать размер флуорофора. Таким образом, разработка и характеристика более мелких, в идеале пар ПЭТ и FRET на основе аминокислот расширит набор инструментов биологической спектроскопии, чтобы открыть новые возможности. Здесь мы показываем, что, в зависимости от длины волны возбуждения, триптофан и 4-цианотрптофан могут взаимодействовать друг с другом через механизм передачи энергии или электронов, таким образом составляя двойную пару FRET и PET.Биологическая полезность этой пары аминокислот дополнительно продемонстрирована путем ее применения для изучения скорости сквозных столкновений короткого пептида, способа взаимодействия между лигандом и BSA и активности протеазы.

У вас есть доступ к этой статье

Подождите, пока мы загрузим ваш контент… Что-то пошло не так. Попробуйте снова?

Лучшие дешевые новые автомобили 2021 года

Покупка новой дешевой машины не означает, что это плохая машина.Поскольку новые автомобили становятся дороже, чем когда-либо, многие покупатели стремятся воспользоваться более доступным вариантом в любом сегменте, в котором они покупают. Не волнуйтесь, потому что мы выбрали лучший недорогой автомобиль в нескольких категориях. Мы рекомендуем их нашим семьям, друзьям и даже вам.

В этом списке вы найдете наши любимые автомобили, выставленные на продажу сегодня, по цене ниже средней. Мы думаем, что они вам понравятся, потому что мы, безусловно, любим.

Джон Вонг / Roadshow

Иногда агрессивный стиль может помочь скрыть посредственный автомобиль, но это не относится к Hyundai Elantra 2021 года.Стиль и содержание сочетаются здесь, чтобы создать доступный компактный седан, который является одним из лучших, которые вы можете купить в настоящее время.

Фанки-стиль внутри и снаружи поможет вам выделиться из традиционно консервативной толпы эконобоксов, но это только начало. Даже базовая Elantra SE оснащена 8-дюймовым сенсорным экраном с wireless Apple CarPlay и Android Auto, широким спектром активных и пассивных систем безопасности и 147-сильным газовым двигателем I4, который обещает расход до 43 миль на галлон по шоссе.Ездить на нем немного хреново, но есть модель N-Line с турбонаддувом, чтобы избавиться от этого зуда. Ешьте пирог и тоже ешьте, ребята.

Прочтите наш обзор Hyundai Elantra 2021 года.

2021 Hyundai Elantra вооружена кучей стиля и технологий

Посмотреть все фото Эндрю Крок / Roadshow

Невозможно составить список отличных доступных автомобилей без упоминания Toyota Camry, бастиона сегмента седанов среднего размера.Конечно, большинство людей говорят о Toyota Camry, как о пакете конвертов, который они купили в Staples, но на это есть веская причина: на протяжении десятилетий Camry оставалась хорошим, надежным и доступным транспортным средством для семей всех форм и размеров.

Неудивительно, что Camry не подает признаков замедления. Негибридная Camry в высшей степени доступна, но она по-прежнему загружена множеством технических систем и систем безопасности в качестве стандартного оборудования, даже в базовой модели LE. Это также довольно плавный оператор, возвращающий хорошо амортизированную поездку, что делает дальние поездки намного короче.

Toyota Camry 2021 года получит немного новых технологий. Посмотреть все фото Стивен Юинг / Roadshow

Полноразмерные седаны медленно идут по пути дронта, но все еще есть некоторые проблемы.Из этой группы Dodge Charger может быть немного длинноватым, но есть удивительное количество ценностей.

Dodge Charger 2021 года, как и предыдущие модели Charger за полдесятилетия, представляет собой большой и удобный седан с рекомендованной производителем розничной ценой, которая пересекает отметку в 30 000 долларов и немного выше, если вы предпочитаете четыре ведущих колеса. до двух. В базовой комплектации двигатель V6 достаточно эффективен, но при этом не заставляет машину чувствовать себя убогой. Бросьте еще немного, и вы сможете заменить его на V8, но все равно будете сидеть ниже средней цены сделки с новым автомобилем.Charger — не самый технологичный автомобиль на планете, но он поставляется с информационно-развлекательной системой Stellantis Uconnect, которая была одной из наших фаворитов на протяжении многих лет, и продолжает улучшаться.

2021 Dodge Charger Redeye имеет большую мощность и широкую стойку

Посмотреть все фото Крейг Коул / Roadshow

«Honda Accord похожа на акции« голубых фишек »: всегда разумная покупка», — пишет наш Крейг Коул в своем обзоре Honda Accord Hybrid 2021 года.И это правда — Accord остается одним из наших неизменных любимых автомобилей, сочетая в себе комфорт, эффективность и динамику в равных долях. Вы можете подумать, что добавление гибридно-электрической трансмиссии потребует компромисса, но нет, это все равно чертовски хорошо.

Имея 212 л.с. и 232 фунт-фута в предложении, Honda Accord Hybrid 2021 года достаточно бодр в реальных условиях, но не нажимайте на педаль акселератора, и вы достигнете расчетной экономии топлива в размере 44 миль на каждый. галлонный город, шоссе на 41 милю на галлон и 43 мили на галлон вместе взятые.Аккумулятор свешивается за задними сиденьями, поэтому он не влияет на объем салона и не влияет на пространство в багажнике, что превосходит как Toyota Camry Hybrid, так и Hyundai Sonata Hybrid. 8-дюймовый сенсорный экран также является стандартным для всей линейки, предлагая Apple CarPlay и Android Auto, первый из которых доступен по беспроводной связи на комплектациях EX и выше.

Прочтите наш обзор Honda Accord Hybrid 2021 года.

2021 Honda Accord Hybrid: скупое вождение без страданий

Посмотреть все фото

Самый доступный электромобиль

2022 Chevrolet Bolt EV

Шевроле

Chevrolet Bolt EV первого поколения был прекрасным, хотя и несовершенным электрическим хэтчбеком.Теперь, в модельном году 2022 года, Bolt EV вернулся с множеством обновлений — и вторым вариантом, о котором мы поговорим позже, — которые делают этот пятидверный автомобиль по-настоящему привлекательным и даже более достойным вашего внимания (и денег). .

Снаружи Bolt EV выглядит более остро, но при этом сохраняет форму хэтчбека. Внутри имеется множество кардинальных улучшений, от общего дизайна до используемых материалов. 10,2-дюймовый информационно-развлекательный экран доминирует на приборной панели, в то время как стандартная технология безопасности включает помощь в удержании полосы движения, автоматическое экстренное торможение и автоматический дальний свет, с адаптивным круиз-контролем и системой камер объемного обзора, доступной в качестве опции.О да, у него также есть дальность действия 259 миль, что для большинства пассажиров — не то, что нужно.

Дэниел Голсон / Roadshow

Honda Civic Type R хороша, но, черт возьми, дорогая.Если вы хотите получить аналогичный, но чуть менее впечатляющий опыт, сэкономив при этом пригоршню денег и раскачивая эстетику, которая на smidge больше взрослого человека, поприветствуйте Hyundai Veloster N 2021 года.

Veloster N получает свою движущую силу от 2.0. -литровый двигатель I4 с турбонаддувом мощностью 250 л.с. (270 л.с. с дополнительным пакетом производительности) и 260 фунт-фут. Шестиступенчатая механическая коробка входит в стандартную комплектацию, но новинка 2021 года — это восьмиступенчатая автоматическая коробка с двойным сцеплением, которая может обеспечить такое же веселое путешествие по бездорожью для людей, которые не хотят грести самостоятельно.Это , так что с очень весело водить, и, как и любой другой новый Hyundai, Veloster N оснащен всевозможными технологиями безопасности и комфорта. Загрузите эту вещь до жабры, и вы все равно не достигнете отметки в 40000 долларов, что дает ему большую ценность среди автомобилей с аналогичными характеристиками.

Прочтите наш обзор Hyundai Veloster N 2021 года.

2021 Hyundai Veloster N по-прежнему самый веселый хот-хэтч

Посмотреть все фото Эндрю Крок / Roadshow

Еще один день, еще один параграф, превозносящий достоинства Ford Baby Bronco, который в конечном итоге стал известен как Bronco Sport.Этот компактный внедорожник покорил наши сердца сочетанием возможностей и качества с небольшой долей ностальгии.

Ford Bronco Sport 2021 года, стоящий ниже отметки в 30 000 долларов за базовую модель, представляет собой впечатляющий небольшой кроссовер. Его высокий корпус означает, что в нем много места и видимости, последнее из которых хорошо сочетается с внедорожными возможностями автомобиля, которые посрамляют почти любой другой крошечный внедорожник. Возможно, он не выигрывает все схватки на бумаге, когда дело доходит до грузового пространства или буксировки, но в Bronco Sport так много смелости, что вы не можете не обожать его.

Прочтите наш обзор Ford Bronco Sport 2021 года.

2021 Ford Bronco Sport готов к горам и торговым центрам

Посмотреть все фото Subaru

Subaru Outback 2021 года может быть немного больше, чем высокий универсал, но в наши дни не нужно много, чтобы квалифицироваться как кроссовер, поэтому для целей этого списка это кроссовер.Однако, независимо от того, в какую категорию он был отнесен, Outback — прекрасный автомобиль, который стоит вашего времени.

Модели 2021 года оснащены одной новой технологией безопасности — светодиодными фарами, которые поворачиваются влево или вправо при повороте рулевого колеса, что дополняет стандартную технологию EyeSight, которую можно найти в каждом Outback. Доступный четырехцилиндровый двигатель с турбонаддувом делает поездки в продуктовый магазин немного более увлекательными, в то время как дополнительный 11,6-дюймовый портретно-развлекательный экран с портретной ориентацией делает довольно привлекательным заявление на приборной панели. У нас была модель 2020 года на целый год, и мы обнаружили, что это в высшей степени компетентный круизер для шоссейных дорог, который продемонстрировал высокую эффективность в процессе.

Subaru Outback Wilderness 2022 года — это гораздо больше, чем крутой внешний вид

Посмотреть все фото Крейг Коул / Roadshow

Считайте Kia Telluride книгой трехрядных внедорожников «Выбери свое приключение».Со стартовой ценой около 32000 долларов вы можете оставить его Ace of Base и уйти из автосалона с совершенно праведным трехрядным внедорожником, который источает семейные ценности и не обанкротится. Или вы можете бросить деньги своему местному продавцу и уехать на Telluride с деревянной отделкой, кожей Nappa и задними рядами с электроприводом складывания. И вы можете получить его где угодно посередине.

Скалы Kia Telluride 2021 года, точка. Он способен, его три ряда предлагают достаточно места для больших семей, чтобы оставаться комфортным в длительных поездках, и он загружен всеми теми же замечательными технологиями, которые мы хвалим во всем остальном, что делают Hyundai и Kia.Его 291-сильный V6, конечно, немного жаждет, но вы можете держать бензоколонки в страхе, придерживаясь стандартного переднего привода. Однако независимо от того, как вы его спроектируете, в результате получается действительно впечатляющий внедорожник.

Прочтите наш обзор Kia Telluride 2021 года.

Эндрю Крок / Roadshow

Если вы водили один из более новых гибридов Honda или если вы управляли бензиновым CR-V нынешнего поколения, вы были бы правы, предполагая, что сочетание этих двух вещей приведет к автомобилю одинаково высокой мощности. качественный.

Honda CR-V Hybrid 2021 года — это как приятный вечер в хорошем ресторане. Хороших времен предостаточно, но не настолько, чтобы ваш кошелек плакал от боли. Трансмиссия CR-V Hybrid способна производить 40 миль на галлон в городе и 35 миль на галлон на шоссе, что является солидным показателем для полноприводного автомобиля, а качество езды оставляет желать лучшего. Добавьте базовую комплектацию стоимостью менее 30 000 долларов и верхнюю часть диапазона, которая стоит около 37 000 долларов, и у вас будет широкий выбор доступных вариантов отделки.

Лучший доступный электрический внедорожник

2022 Chevrolet Bolt EUV

Стивен Юинг / Roadshow

Bolt EV больше не единственный доступный электромобиль в портфеле Chevrolet.Теперь есть версия кроссовера с более высокой посадкой, Bolt EUV, которая выглядит в основном так же, но на самом деле не имеет общего листового металла со своим братом. Здесь все то же самое, что и от Bolt EV, в том числе красиво оформленный интерьер с лучшими материалами и некоторыми надежными стандартными технологиями. На фотографиях это может выглядеть не так, но на самом деле EUV на полфута длиннее, чем EV, с соответствующим увеличенным внутренним пространством.

Но одна очень важная вещь отличает Bolt EUV от любого потенциального конкурента: Super Cruise.Ранее ограниченная дорогими автомобилями Cadillac, расширенная система помощи водителю GM теперь доступна и на Bolt EUV. Нажмите кнопку на любом из более чем 200 000 миль нанесенного на карту шоссе, и автомобиль возьмет на себя управление рулевым управлением, тормозами и акселератором, чтобы пользоваться рулевым управлением без помощи рук.

Эндрю Крок / Roadshow

Является ли Mazda CX-5 Turbo 2021 года технически производительным внедорожником? Ну, нет, но пока не появится Hyundai Kona N, CX-5 с его двигателем I4 с турбонаддувом обеспечивает впечатления, максимально приближенные к ориентированному на производительность автомобилю в этом ценовом диапазоне.

Доступный в более высоких комплектациях, дополнительный 2,5-литровый двигатель I4 с турбонаддувом CX-5 выдает солидные 250 л.с. и 320 фунт-фут, последний из которых делает некоторые очень захватывающие старты и выходки на рампе. Прочный корпус и должным образом демпфированная подвеска позволят вам получить удивительное удовольствие в поворотах, а внутренняя отделка салона с правильными характеристиками может посрамить некоторые настоящие роскошные автомобили как с точки зрения материалов, так и с точки зрения стиля.

Сравнение лучших доступных автомобилей на 2021 год

Категория Имя Базовый двигатель Выход Экономия топлива (миль на галлон, город / шоссе / комбинированный) Базовая цена
Лучший недорогой малолитражный автомобиль Hyundai Elantra 2021 года 2.0-литровый I4 147 л.с. / 132 фунт-фут 33/43/37 20 655 долларов США
Лучший доступный автомобиль среднего размера Тойота Камри 2021 года 2.5-литровый I4 203 л.с. / 184 фунт-фут 28/39/32 25 965 долл. США
Лучший доступный полноразмерный автомобиль Dodge Charger 2021 года 3.6-литровый V6 292 л.с. / 260 фунт-футов 19/30/23 31 490 долларов США
Лучший доступный гибридный автомобиль Honda Accord Hybrid 2021 года 2.0-литровый гибрид I4 212 л.с. нетто 48/48/48 27 565 долларов США
Лучший доступный электромобиль Chevrolet Bolt EV 2022 года Один электродвигатель 200 л.с. / 266 фунт-футов TBA (259 миль.расчетный диапазон) 31 995 долл. США
Лучший доступный по цене автомобиль Hyundai Veloster N 2021 года 2.0-литровый I4 275 л.с. / 260 фунт-футов 22/28/25 33 245 долларов США
Лучший доступный небольшой внедорожник Ford Bronco Sport 2021 года 1.5-литровый I3 181 л.с. / 190 фунт-футов 25/28/26 29 650 долл. США
Лучший доступный среднеразмерный внедорожник Subaru Outback 2021 года 2.5-литровый h5 182 л.с. / 176 фунт-фут 26/33/29 27 845 долларов США
Лучший доступный трехрядный внедорожник Kia Telluride 2021 года 3.8-литровый V6 291 л.с. / 262 фунт-фут 20/26/23 33 415 долл. США
Лучший доступный гибридный внедорожник Honda CR-V Hybrid 2021 года 2.0-литровый гибрид I4 212 л.с. нетто 40/35/38 31 710 долл. США
Лучший доступный электрический внедорожник Chevrolet Bolt 2022 года выпуска Один электродвигатель 200 л.с. / 266 фунт-футов TBA (250 миль.расчетный диапазон) 33 395 долл. США
Лучший доступный по цене внедорожник Mazda CX-5 Turbo 2021 года 2.5-литровый I4 250 л.с. / 320 фунт-футов 23/28/25 31 760 долл. США

Как мы попали в наш список

Вы не поверите, но мы их погнали! Все в Roadshow постоянно оценивают новые автомобили в любых ситуациях, будь то транспортировка мульчи или просто транспортировка семьи из пункта А в пункт Б.Наша обширная библиотека опубликованных обзоров позволяет нам рассматривать каждый автомобиль в контексте и определять, что делает его действительно хорошим. Имена, которые вы видите в этом списке, представляют некоторые из наших любимых доступных автомобилей из всех уголков автомобильной промышленности — за исключением, естественно, супердорогих.

Но не забывайте: ваш пробег может отличаться, и не только буквально. У всех разные потребности, и то, что хорошо для одного гуся, может не подходить для гусака. Нам приятно, если вы хотите принять этот список как канонический, но мы умоляем вас выйти и по-настоящему прокатиться на этих и других машинах, чтобы почувствовать, что вы, , действительно хотите. средство передвижения.

Подробнее: Лучшие кабриолеты на 2021 год

Садитесь за руль и узнавайте последние новости и обзоры автомобилей, которые отправляются вам на почту два раза в неделю.

(PDF) Физические модели для быстрой оценки гитарной струны, лада и положения защелкивания

2019 Семинар IEEE по приложениям обработки сигналов в аудио и акустике 20-23 октября 2019 года, Нью-Палтц, Нью-Йорк

6.СПИСОК ЛИТЕРАТУРЫ

[1] К. Р. Салливан, «Расширение алгоритма Karplus-Strong до

синтезирует тембры электрогитары с искажением и обратной связью», Computer Music Journal, vol. 14, вып. 3, pp. 26–37,

1990.

[2] M. Karjalainen, V. V¨

alim¨

aki и Z. J´

anosy, «На пути к высокому качеству звука —

. синтез гитары и струнных инструментов »,

Proc. Int. Конференция компьютерной музыки, 1993, с. 56–63.

[3] М. Лаурсон, К. Эркут, В. V¨

alim¨

aki и М. Куусканкаре,

«Методы моделирования реалистичной игры на акустической гитаре

синтез», Computer Music Journal, т. 25, нет. 3, стр. 38–

49, 2001.

[4] К. Келинг, Дж. Абессер, К. Диттмар и Г. Шуллер, «Auto-

транскрипция матической табулатуры с записей электрогитары по оценке

. параметров партитуры и инструмента », Тр.

Внутр.Конф. Digital Audio Effects, 2014.

[5] Дж. Абессер и Х. Лукашевич, «Основанное на характеристиках извлечение

щипковых и экспрессионных стилей электрического баса», в Proc.

IEEE Int. Конф. Acoust., Speech, Signal Process., 2012.

[6] A. Pat´

e, J.-L. Ле Карру и Б. Фабр, «Предсказание

времени затухания тонов твердотельной электрогитары», J. Acoust. Soc. Am.,

т. 135, нет. 5, pp. 3045–3055, 2014.

[7] Z. Mohamad, S.Диксон и К. Харт, «Оценка положения звукоснимателя и

точек защипывания на электрогитаре», в Proc. IEEE

Int. Конф. Acoust., Speech, Signal Process., 2017.

[8] С. Траубе и Дж. О. Смит, «Оценка точки защипа на гитарной струне

», Proc. Int. Конф. Digital Audio Effects, 2000.

[9] Х. Пенттинен и В. V¨

alim¨

aki, «Подход к

во временной области, оценивающий точку перехвата гитарных тонов, полученную с помощью

под- седельный звукосниматель », Прикладная акустика, т.65, нет. 12, pp.

1207–1220, 2004.

[10] Х. Пенттинен, Й. Сийсконен и В. В.

alim¨

aki, «Акустическая гитара

оценка точки ощипывания в реальном времени. Proc. IEEE Int. Конф.

Акуст., Речь, обработка сигналов, т. 3, pp. 209–212, 2005.

[11] C. Erkut, V. V¨

alim¨

aki, M. Karjalainen и M. Laurson, «Ex-

тяга физического и выразительного параметры для модели

синтез звука классической гитары на основе », в Audio Eng.

Soc., 2000.

[12] Дж. Абессер, «Автоматическое определение струн для бас-гитары и

электрогитары», От звуков к музыке и эмоциям, стр. 333–

352, 2013.

[ 13] Ф. Жермен и Г. Евангелиста, «Синтез гитары с помощью цифровых волноводов

: моделирование плектра при физическом взаимодействии

игрока с инструментом», Proc. IEEE Workshop on

Appl. сигнального процесса. к Ауд. and Acoust., стр. 25–28, 2009.

[14] Г. Евангелиста и Ф. Экерхольм, «Модели взаимодействия проигрывателя и инструмента для цифрового волноводного синтеза гитары: прикосновение

и столкновения», IEEE Trans. Audio, Speech, Language Pro-

cess., Vol. 18, нет. 4, pp. 822–832, 2010.

[15] С. Пуаро, С. Бильбао, М. Арамаки и Р. Кронланд Мартине,

«Морфология звука, обусловленная нелинейными взаимодействиями: к

Управление процессами синтеза звуков окружающей среды

»в сб.Int. Конф. Digital Audio Effects, 2018.

[16] С. Бильбао и А. Торин, «Численное моделирование и звуковая синхронизация

, тезис для взаимодействия сочлененных струн и грифа», J. Audio

Eng. Soc., Т. 63, нет. 5, стр. 336–347, 2015.

[17] Н. Х. Флетчер, Т. Д. Россинг, Физика музыкальных инструментов

, 2-е изд. Springer, 1998.

[18] ——, Принципы вибрации и звука, 2-е изд. Springer,

2004.

[19] W. F. Donkin, Acoustics, 2nd ed.Oxford Clarendon Press,

1884.

[20] Л. Рэлей, Теория звука, 1-е изд. MacMillan and

Co. Ltd. Лондон, 1894.

[21] Р. С. Шенкленд и Дж. У. Колтман, «Отличие

обертонов вибрирующей проволоки от истинного гармонического ряда», J.

Acoust. Soc. Am., Т. 10, вып. 3, pp. 161–166, 1939.

[22] Т. Д. Россинг, Наука о струнных инструментах, 1-е изд.

Springer, 2010.

[23] I. Barbancho, L.Тардон, С. Саммартино и А. Барбанчо,

«Метод на основе негармоничности для автоматического создания гитарной табулатуры

», IEEE Trans. Audio, Speech, Language Pro-

cess., Vol. 20, нет. 6, pp. 1857–1868, 2012.

[24] C. Dittmar, A. M ¨

annchen и J. Abeßer, «Обнаружение строк tar в реальном времени для программного обеспечения музыкального образования», Proc. . Int.

Практикум по анализу изображений для мультимедийных интерактивных сервисов

vices, стр.1–4, 2013.

[25] Х. Флетчер, «Нормальные частоты колебаний жесткой струны фортепиано

», J. Acoust. Soc. Am., Т. 36, pp. 203–209, 1964.

[26] Дж. Дж. Михельсон, Р. М. Стерн и Т. М. Салливан, «Автоматическая транскрипция гитарной табулатуры

из аудио с использованием негармоничности

регрессии и байесовской классификации», в Audio Eng. Soc.,

2018.

[27] Дж. Хьеррилд и М. Кристенсен, «Оценка гитарной струны, лада

и положения защипа с использованием параметрической оценки высоты тона»,

Принято для Proc.IEEE Int. Конф. Acoust., Speech, Signal

Process., 2019. [Online]. Доступно: http://vbn.aau.dk/files /

296639129 / icassp оценка положения щипания.pdf

[28] А. Галембо и А. Аскенфельт, «Измерение негармоничности

путем извлечения звука», Журнал STL- QPSR, т. 35, нет. 1,

pp. 135–144, 1994.

[29] Т. Нильссон, С. Адалбьорнссон, Н. Батт и А. Якобсен,

«Оценка негармонических сигналов с помощью нескольких шагов», Proc. Евро-

pean Signal Processing Conf., pp. 1–5, 2013.

[30] Дж. М. Филлипс, «Дизайн Джеффри Филлипса», 2018 г. [Online].

Доступно: http://www.imjeffp.com/

[31] И. Ферт, Р. Бейн и А. Галлахер, «Уравнения проектирования струн»,

Journal of the Catgut Acoustical Society, vol. 46, pp. 3–6,

1984.

[32] Дж. А. Кемп, «Физика разматываемых и намотанных струн на электрогитаре

применительно к интервалам высоты звука, создаваемым системами тремоло / вибрато

», PLOS One, 2017.

[33] П. Р. Чайлдс, Справочник по машиностроению.

Butterworth-Heinemann, 2014.

[34] О. Лартиллот и П. Тойвиайнен, «Набор инструментов Matlab для извлечения музыкальных функций

», Proc. Int. Конф. Digital Audio Effects,

2000.

Произошла ошибка при настройке вашего пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки вашего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Скрининг эпигенетических биомаркеров FLIM-FRET для комбинированной терапии при раке груди + ER | Clinical Epigenetics

Клеточная культура

Клетки MCF7 (ATCC) регулярно культивировали в среде Игла, модифицированной Дульбекко (DMEM) с добавлением 10% фетальной бычьей сыворотки (Atlanta Biologicals), 100 МЕ / мл пенициллина и 100 мкг / мл стрептомицина в увлажненной среде. инкубатор с 5% CO 2 при 37 ° C.Клетки субкультивировали в среде DMEM без фенолового красного с 10% покрытой декстраном плодной телячьей сывороткой (CS-FBS) (CS-FBS) (Atlanta Biologicals) и в пределах от 2 до 5 пассажей.

Клетки

T47D культивировали в среде Rosewell Park Memorial Institute (RPMI) с добавлением 10% фетальной бычьей сыворотки, 100 МЕ / мл пенициллина и 100 мкг / мл стрептомицина. Клетки субкультивировали в RPMI без фенолового красного с 10% CS-FBS для экспериментов и в течение 10 пассажей.

Иммунофлуоресцентное окрашивание

Клетки фиксировали 4% параформальдегидом в течение 15 минут и промывали 1 × фосфатно-солевым буфером (PBS).Клеточную мембрану пропитывали 0,5% Triton X-100 (Sigma) в течение 20 минут и промывали PBS в течение 10 минут. После денатурации ДНК с помощью HCl (необязательный этап окрашивания 5hmC / 5fC / 5caC) клетки затем блокировали PBS, содержащим 5% козьей сыворотки и 0,3% Triton X-100, в течение 1 часа. Первичные антитела разводили в PBS, содержащем 1% BSA и 0,3% Triton X-100, затем добавляли к клеткам и инкубировали в течение ночи при 4 ° C. На следующий день клетки промывали PBS. Затем образцы инкубировали с соответствующими разбавленными вторичными антителами в течение 1 ч и промывали PBS перед визуализацией FLIM.Основными антителами, используемыми в этом исследовании, являются гистон h4K9me3 (39765, активный мотив), гистон h4K27me3 (39155, активный мотив), 5-гидроксиметилцитозин (5-hmC) (39791, активный мотив), 5-формилцитозин (5-fC) (61227 , Активный мотив), 5-карбоксилцитозин (5-caC) (61229, активный мотив), триметил K4 против гистона h4 (ab8580, Abcam), ацетил K12 против гистона h5 (ab46983, Abcam), гистон h4K27ac (pAb39133 , Active Motif), анти-MBD1 (ab108510, Abcam), анти-MBD2 (ab38646, Abcam), анти-MBD3 (ab115692, Abcam) и ERα (sc-8002, Санта-Круз).Антитела разводили в соответствии с рекомендациями производителя. Вторичные антитела представляют собой козьи антимышиные антитела Alexa Fluor 546 (1: 2000) и козьи антимышиные антитела Alexa Fluor 488 (1: 2000) (Invitrogen, A11071 и A11070). Для иммуноокрашивания тканей криосрезы ткани рака молочной железы (ERα +) (толщиной 5 мкм) фиксировали свежим формалином и заливали парафином (предоставленным доктором Сунил Бадев из Медицинской школы Университета Индианы в соответствии с существующим протоколом). Затем предметные стекла депарафинизировали растворами ксилола и повторно гидратировали этанолом.Получение индуцированного нагреванием эпитопа проводили в кипящем буфере Tris-EDTA (TBS, pH = 9,0) в течение 20 минут с последующей тщательной промывкой 0,025% Triton X-100. ДНК денатурировали 1 М HCl в течение 30 мин при 37 ° C (окрашивание 5hmC / 5fC / 5caC). Затем тканевые слайды блокировали буфером TBS, содержащим 1% BSA и 10% козьей сыворотки. Затем слайды инкубировали с 5 нМ первичных антител во влажной камере в течение ночи при 4 ° C. На следующий день наносили вторичные антитела, разведенные 1: 2000, на 1 ч при комнатной температуре.После промывания свежим буфером PBS предметные стекла запечатывали в монтажной среде VECTASHIELD (Life Technologies) для визуализации FLIM.

Визуализация времени жизни флуоресценции на основе резонансного переноса энергии Фёрстера

Конфокальная визуализация времени жизни флуоресценции (FLIM) выполнялась с помощью сканирующей конфокальной системы микроскопов с временным разрешением Microtime200 (Picoquant GmbH) или Alba (ISS, Champaign). Детали приборов описаны ранее [35]. Для Microtime200 использовался пикосекундный импульсный лазер 465 нм с частотой повторения 40 МГц для возбуждения антитела ALEXA488 через апохроматический иммерсионный объектив (× 60, NA = 1.2). Фотоны собирались тем же объективом и проходили через точечное отверстие 50 мкм и полосовой фильтр (520/40 нм, Chroma) перед достижением лавинного фотодиода (SPCM-AQR, PerkinElmer Inc.). Обнаруженные фотоны сохранялись в формате с временным разрешением (TTTR) для создания гистограмм коррелированного по времени однофотонного счета (TCSPC) (TimeHarp 200, Picoquant). Мощность лазера контролировалась так, чтобы максимальное значение фотона составляло ~ 10 4 на гистограмме TCSPC. Время жизни флуоресценции ( τ ) было получено путем аппроксимации картины затухания TCSPC как F ( t ) = F 0 e t / τ , (1).

Для Alba использовали пикосекундный импульсный лазер 488 нм с частотой повторения 20 МГц для возбуждения антитела ALEXA 488 через апохроматический иммерсионный объектив (× 60, NA = 1,2). Фотоны собирались тем же объективом, отражались дихроичным фильтром 560 (Chroma) и проходили через точечное отверстие 50 мкм и полосовой фильтр (525/50, Chroma), прежде чем попасть на лавинный фотодиод. Обнаруженные фотоны сохранялись в формате TTTR и генерировали гистограмму TCSPC (Беккер и Хикл).

Фёрстеровский резонансный перенос энергии (FRET) был использован для исследования потенциального молекулярного взаимодействия между эпигенетическими модификациями и ERα путем оценки расстояния между ними.Были приготовлены ERα-ALEXA 488 и различные эпигенетические модификации, нацеленные на комплексы антитело-ALEXA 546, и эффективность FRET была рассчитана на основе следующего уравнения: \ (E = 1- \ raisebox {1ex} {$ {\ tau} _ {da} $} \! \ left / \! \ raisebox {-1ex} {$ {\ tau} _d $} \ right. \), (2) где τ da — время жизни клеток, меченных двойными антителами. , а τ d — время жизни только донорных клеток [36,37,38].

Анализы жизнеспособности клеток МТТ

Приблизительно 7000 клеток MCF7 высевали на лунку в 96 лунках, снабженных DMEM без фенолового красного, 10% CS-FBS, 100 МЕ / мл пенициллина и 100 мкг / мл стрептомицина.Точно так же клетки T47D культивировали с RPMI без фенолового красного, 10% CS-FBS и антибиотиками. После 24 часов инкубации добавляли различные концентрации тамоксифена, CPTh3, MB-3 и анакардовой кислоты и инкубировали в течение 48 часов. Все препараты были приобретены у Sigma-Aldrich, растворены в ДМСО, аликвотированы в небольшие пробирки и хранятся при -20 ° C. В конце обработки 20 мкл 3- (4,5-диметилтиазол-2-ил) -2,5-дифенилтетразолийбромида (МТТ) добавляли в каждую лунку из 5 мг / мл исходного раствора в PBS, и 96-луночный планшет инкубировали 3 раза.5 ч. Среду для культивирования клеток осторожно удаляли и в каждую лунку добавляли 150 мкл растворителя МТТ, состоящего из 4 мМ HCl, 0,1 ( v / v )% IGEPAL CA-630 в изопропаноле. Планшет помещали на шейкер на 15 мин перед считыванием оптической плотности при 570 нм. В качестве фона использовали лунки без клеток, но с растворителем МТТ. Фоновое поглощение усредняли, а затем вычитали из всех других показаний. В каждом эксперименте лечение лекарствами проводилось в четырех повторностях, а значения усреднялись.

Количественная оценка глобального ацетилирования гистонов

Обработанные лекарством клетки и ткань ксенотрансплантата мышей обрабатывали трипсином и собирали для экстракции гистонов с помощью набора EpiQuik Total Histone Extraction Kit (Epigentek). Экстрагированный гистоновый белок анализировали на 18% геле SDS-PAGE и окрашивали кумасси синим. Концентрации общего гистонового белка измеряли с помощью набора для анализа белков BCA (Pierce) в трех экземплярах. Количественное определение изменений h5K12ac или h4K27ac проводили с помощью набора EpiQuik Global Acetyl-Histone h5-K12 / h4K27 Quantification Kit (Epigentek) в соответствии с инструкциями производителя.

Экстракцию гистонового белка подвергали электрофорезу на 12% протеиновых гелях Mini-PROTEAN (Bio-rad) и переносили на мембрану из поливинилидендифторида (PVDF) (Bio-rad). После инкубации с 5% обезжиренным молоком в течение 1 ч блоты зондировали антителом h5K12ac (1: 1000, Santa Cruz Biotechnology) или антителом h5 (1: 1000, Santa Cruz Biotechnology) в трис-буферном физиологическом растворе с Tween 20 ( TBST) плюс 5% обезжиренное молоко при 4 ° C в течение ночи. Козье антимышиное антитело, конъюгированное с HRP, использовали в качестве вторичного антитела.

Количественная RT-PCR

Клетки ~ 10 000 клеток / мл помещали в колбы T25, снабженные DMEM (без фенолового красного), 10% CS-FBS, 100 МЕ / мл пенициллина и 100 мкг / мл стрептомицина в течение 2 дней. Затем добавляли препараты в различных концентрациях и клетки инкубировали 48 ч перед трипсинизацией. Экстракцию РНК из клеток или опухолевых тканей выполняли с помощью набора RNeasy Mini Kit (Qiagen) с последующей обратной транскрипцией с помощью набора для синтеза кДНК iScriptTM (Bio-Rad) в соответствии с инструкциями производителя.Амплификацию с помощью полимеразной цепной реакции (ПЦР) проводили в системе StepOnePlusTM (Applied Biosystems) с SYBR® Green PCR Master Mix (Life Technologies). Метод ΔΔCt использовали для определения кратного изменения уровня транскрипции гена и нормализовали по контрольному гену GAPDH. GAPDH-F: CAGCCTCAAGATCATCAGCA; GAPDH-R: TGTGGTCATGAG TCCTTCCA; GREB1-F: CAAAGAATAACCTGTTGGCCCTGC; GREB1-R: GACATGCCTGCGCTCTCATACTTA; CCND1-F: TGGAGGTCTGCGAGGAACAGAA; CCND1-R: TGGAGGTCTGCGAGGAACAGAA; TFF1-F: GAACAAGGTGATCTGCG и TFF1-R: TGGTATTAGGATAGAAGCACCA были разработаны на основе Primer-BLAST онлайн.

Ксенотрансплантат мышей

Все эксперименты на животных проводились в соответствии с утвержденным протоколом Purdue Animal Care and Use Committee (PACUC) в аккредитованном AAALAC учреждении с круглосуточной ветеринарной помощью. Самок мышей NSG (19-25 г) в возрасте от 11 до 15 недель получали из колонии Jackson Labs BESR. Мышей содержали в стандартных условиях с относительной влажностью 50 ± 10%, 20 ± 1 ° C и 12-часовым циклом свет / темнота. Гранулы 17β-эстрадиола (E2) с высвобождением шестидесяти дней (0,36 мг / осадок, Innovative Research of America) вводили на плечи подкожно через троакар.Примерно 3 × 10 6 клеток MCF7 (ATCC) подкожно инокулировали в правый бок животных, соответственно. После того, как длина опухоли достигла ~ 7 мм, этих мышей случайным образом разделили на шесть групп и начали лечение. Лекарства растворяли в PBS небольшими аликвотами и замораживали при -20 ° C в темноте перед использованием. Мышам внутрибрюшинно вводили лекарственные средства в дозировке, зависящей от веса мышей (контрольная группа 100 мкл 3% ДМСО в PBS, тамоксифен: 4 мг, кг -1 , анакардовая кислота 0.3 мг кг -1 или 1 мг кг -1 ). Объемы ксенотрансплантата опухоли измеряли с помощью штангенциркуля и рассчитывали с использованием уравнения L × W 2 /2, где W — ширина опухоли, а L — длина опухоли.

Иммунопреципитация хроматина

Анализы иммунопреципитации хроматина (ChIP) проводили с использованием набора EpiQuik Tissue Chromatin Immunoprecipitation Kit (Epigentek) в соответствии с инструкциями, поставляемыми с небольшими модификациями согласно предложениям производителя.Около 50 мг ткани было разрезано на 1–2 мм 3 кусочков и сшито 1% формальдегидом в течение 15 мин при комнатной температуре на качающейся платформе. Последующий лизис клеток и разрезание ДНК завершали перед инкубацией тканевых экстрактов с ERα (F-10X, Santa Cruz), ацетил K12 против гистона h5 (ab46983, Abcam) или нормальным мышиным IgG (Epigentek). После иммунопреципитации белок / ДНК было выполнено обращение поперечно-сшитой ДНК, и ДНК была очищена с использованием реагента из комплекта (Epigentek).Праймер для GREB1 [21] qRT-PCR: Forward-5′-GCCAAATGGAAGAAGGACAG-3 ‘; Использовали обратный 5’-ACCACCTACCTCCAGTCACC-3 ‘. Праймер для TFF1 [39, 40]: вперед-5’-GGCAGGCTCTGTTTGCTTAAAGAGCG-3 ‘; Обратный 5’-GGCCATCTCTCACTATGAATCACTTCTGC-3 ‘.

Статистический анализ

Двусторонние тесты Стьюдента t были выполнены для определения разницы между усредненным средним значением. Статистически значимым считалось значение p <0,05.

Оценка FRET X для фингерпринтинга одномолекулярных белков

Abstract

Идентификация одномолекулярных белков — это новая, пока еще нереализованная концепция с потенциально революционными приложениями в биологических исследованиях.Мы предлагаем метод под названием FRET X (Förster Resonance Energy Transfer via DNA eXchange), при котором эффективность FRET считывается между заменяемыми красителями на стыковочных цепях ДНК, связанных с белком, а накопленные значения эффективности FRET составляют отпечаток для белка. Чтобы оценить осуществимость этого подхода, мы смоделировали отпечатки пальцев для сотен белков с использованием модели крупнозернистой решетки и экспериментально продемонстрировали снятие отпечатков пальцев FRET X на системе модельных пептидов.Измеренные отпечатки пальцев согласуются с нашим моделированием, подтверждая обоснованность нашего подхода к моделированию. В смоделированной сложной смеси> 300 белков человека, из которых были помечены только цистеины, лизины и аргинины, машина опорных векторов была способна идентифицировать составляющие с точностью 95%. Мы ожидаем, что наш подход FRET X fingerprinting сформирует основу инструмента анализа целевой протеомики.

Введение

Белки бывают самых разных форм, размеров и форм.Каждый настроен на выполнение одной или нескольких функций, которые необходимы живым клеткам, включая катализ метаболических реакций, репликацию генетической информации, обеспечение структурной поддержки, перенос молекул и многое другое. Чтобы полностью понять биологические процессы, происходящие в клетке, очень важно идентифицировать и количественно определять составляющие ее протеома в любой момент времени в течение клеточного цикла.

Масс-спектрометрия (МС) в настоящее время является золотым стандартом для идентификации и количественного определения белков.За последние десятилетия методы МС значительно улучшились с точки зрения точности и динамического диапазона; однако обнаружение и различение всех белков в сложных образцах остается сложной задачей. Многие биологически и клинически значимые белки, такие как сигнальные молекулы и биомаркеры болезней, встречаются в таком низком количестве, что они остаются не обнаруживаемыми РС. 1 Более того, сложность протеома увеличивается за счет альтернативного сплайсинга или посттрансляционных модификаций, поскольку один ген может продуцировать десятки различных разновидностей белка, называемых протеоформами. 2 Не все эти протеоформы можно выделить с помощью современных подходов. Таким образом, существует значительный стимул для разработки новых методов секвенирования белков, которые работают на уровне одной молекулы. 3,4

Одномолекулярные методы улучшили секвенирование ДНК, позволяя идентифицировать отдельные молекулы нуклеиновых кислот, и в настоящее время обычно используются для картирования генома и транскриптома отдельных клеток. 5 Однако поиск методов секвенирования одномолекулярных белков не является тривиальным из-за высокой сложности белковых молекул по сравнению с молекулами ДНК.Например, код ДНК состоит всего из четырех нуклеотидов, тогда как для белков существует двадцать различных аминокислот. Кроме того, молекулы ДНК с низким содержанием могут быть ферментативно амплифицированы вне клетки, тогда как такой фермент отсутствует для белков.

Были предложены новые методы анализа одномолекулярных белков, чтобы обойти эту дополнительную сложность. Важно отметить, что в природе встречается только подмножество теоретически возможных комбинаций полипептидных цепей, и часть этого подмножества имеет значение в данной исследовательской среде.Следовательно, белки могут быть идентифицированы путем считывания подписи неполной информации, которая затем сравнивается с базой данных соответствующих подписей. Мы называем этот подход протеиновым фингерпринтингом, а белковые сигнатуры — протеиновыми фингерпринтами. Было показано, что достаточно отличные белковые отпечатки пальцев требуют считывания только небольшого подмножества типов остатков. 6-8 Если остатки цистеина и лизина были помечены ортогонально и считывались последовательно, наше моделирование показало, что большинство белков человека можно было однозначно идентифицировать.

Недавно было продемонстрировано несколько новых методов фингерпринтинга белков, основанных на считывании подмножества типов остатков, большинство из которых требует линеаризации полипептидной цепи для определения порядка остатков. 9,10 Эта линеаризация может быть достигнута путем транслокации полипептидной цепи через нанопоры 4 или с помощью флуоресцентно меченного моторного белка 8 для считывания модифицированных остатков, необходимых для снятия отпечатков пальцев.Альтернативно, «отпечаток пальца» белка можно получить, пометив определенные аминокислоты и определив их местоположение с помощью нескольких циклов деградации по Эдману 11 . Хотя полноразмерные белки трудно анализировать из-за ограниченного количества циклов Эдмана, которые могут быть выполнены, его полезность для анализа более коротких пептидов была показана в качестве доказательства концепции. Общим для всех этих подходов является то, что они исследуют каждый белок только один раз, в то время как точность повысится, если одну и ту же молекулу можно будет измерить несколько раз.

В этом исследовании мы представляем новый метод фингерпринтинга белков, который основывается на концепции специфичного для остатков мечения выбранных аминокислот и позволяет получить фингерпринт белка путем определения местоположения аминокислот в трехмерной структуре белка. Поскольку размер большинства белков находится в низком нанометровом диапазоне, наш подход к фингерпринтингу белков требует техники, которая может определять местоположение остатков с субнанометровым разрешением. Одномолекулярный FRET хорошо подходит для этого и обладает преимуществом, заключающимся в том, что несколько тысяч молекул могут быть отображены одновременно, если белки полной длины могут быть иммобилизованы в микрофлюидной камере. 12 Здесь мы проверяем возможность использования метода фингерпринтинга одномолекулярных белков на основе FRET. Сначала мы демонстрируем, что экспериментально полученные отпечатки пальцев для четырех модельных пептидов отличаются и воспроизводятся с помощью нашего метода моделирования. Затем мы показываем, что смоделированные отпечатки пальцев 313 составляющих протеома человека могут быть идентифицированы с точностью 95%. Если предполагается неправильная маркировка остатков, эта точность снижается до 91%. Это подтверждает мнение о том, что снятие отпечатков пальцев FRET позволяет надежно идентифицировать белки в сложных смесях.

Подход

FRETX для снятия отпечатков пальцев

Для реализации снятия отпечатков пальцев с использованием одномолекулярного FRET требуется разрешение, достаточное для определения местоположения нескольких аминокислот в структуре белка. Однако анализ FRET одной молекулы ограничивается одной или двумя парами FRET за одно измерение. 13,14 Недавно наша группа разработала концепцию, позволяющую обнаруживать несколько пар FRET в одном наноскопическом объекте. Наша методика FRET X (FRET посредством обмена ДНК) использует временную гибридизацию цепей ДНК, меченных флуорофором, для временного разделения событий FRET, которые происходят из разных пар FRET.Мы показали, что FRET X может определять расстояние между несколькими парами FRET с субнанометровой точностью. 15 Здесь мы применяем FRET X для снятия отпечатков пальцев. Обнаруживая целевые аминокислоты одну за другой, FRET X создает уникальный отпечаток пальца, позволяющий идентифицировать белок из справочной базы данных.

Рисунок 1 иллюстрирует рабочий процесс для снятия отпечатков пальцев с использованием FRET X. Подмножество аминокислот интересующего белка помечено ортогональными последовательностями ДНК, которые служат стыковочными цепями для их дополнительных цепей формирователя изображения ( Рисунок 1A ).Один из концов помечен уникальной последовательностью ДНК, которая функционирует как контрольная точка и облегчает иммобилизацию полноразмерного белка на микрофлюидном чипе. Чтобы получить отпечаток FRET для одной из аминокислот, добавляются флуоресцентно меченые цепи формирователя изображения для концевой эталонной последовательности и для конкретной аминокислоты (например, цистеина, , рис. 1В, ). Нити имидж-сканера для контрольной точки помечены акцепторным флуорофором, а нити для цистеина несут донор.FRET может возникнуть только тогда, когда обе нити тепловизора связаны одновременно. Временное и повторяющееся связывание нитей имидж-сканера сообщает об относительном расположении остатка по отношению к контрольной точке. Кроме того, поскольку пул флуорофоров постоянно пополняется, эффект фотообесцвечивания смягчается, и мы можем исследовать каждый остаток несколько раз, тем самым повышая точность. После получения достаточного количества событий FRET можно построить отпечаток FRET, сообщающий о расстоянии каждой целевой аминокислоты от контрольной точки.Затем микрофлюидную камеру промывают и вводят новый раствор для визуализации, чтобы исследовать вторую аминокислоту (например, лизин) ( Рисунок 1C ). Цикл FRET X может повторяться для любого количества и типа аминокислот, если они помечены ортогональными последовательностями ДНК. Обнаружение нескольких типов аминокислот улучшает уникальность отпечатка пальца белка, тем самым повышая вероятность идентификации. Определенные значения эффективности FRET для каждой аминокислоты объединяются для создания «отпечатка пальца» белка, с помощью которого белок можно идентифицировать по справочной базе данных (, рис. 1D, ).

Рисунок 1

Концепция FRET X для снятия отпечатков пальцев. (A) Подмножество аминокислот (здесь цистеины и лизины) помечены ортогональными последовательностями ДНК, которые функционируют как сайты стыковки для комплементарных, флуоресцентно меченных цепей имидж-сканера. Другая ортогональная последовательность ДНК конъюгирована с одним из концов белка, который служит местом стыковки акцептора и облегчает иммобилизацию белка на микрофлюидном устройстве. (B) В первом раунде визуализации FRET X нити формирователя изображения, которые гибридизуются с местом стыковки цистеина (желтые кружки), и те, которые гибридизуются с контрольной точкой (красные кружки), вводятся в микрофлюидную камеру.И донорные, и акцепторные меченые цепи имидж-сканера временно взаимодействуют со своими комплементарными стыковочными цепями. Когда оба присутствуют одновременно, может возникнуть FRET, и эффективность FRET определяется между цистеином и контрольной точкой. Каждую из трех пар FRET исследуют отдельно, что дает определение эффективности FRET ( E ), которая составляет отпечаток цистеина. (C) Камеру промывают и повторяют визуализацию FRET X для исследования отпечатка пальца лизина.Этот цикл FRET X можно повторить для исследования дополнительных аминокислот и получения дополнительных отпечатков пальцев. (D) Эффективности FRET для отдельных аминокислот объединяются, чтобы получить отпечаток белка, который можно сопоставить со справочной базой данных для идентификации белка.

Моделирование отпечатков пальцев

Полезность нашего метода зависит от его способности распознавать отпечатки пальцев FRET X, полученные из многих различных белков. Мы запускаем моделирование, чтобы оценить этот сценарий.Моделирование отпечатка пальца FRET X для данного белка представляет собой сложную задачу, поскольку отпечаток пальца включает в себя как последовательность, так и структурную информацию. Несмотря на то, что в последнее время в предсказании структуры белков произошли значительные улучшения, передовые методы 16,17 остаются слишком дорогостоящими с точки зрения вычислений для оценки многих белков. Кроме того, они не могут объяснить наличие конъюгированных ДНК-тегов. Вместо этого мы решили использовать менее интенсивный в вычислительном отношении подход к моделированию решетки 18 , в котором каждый остаток представлен в виде одного псевдоатома, ограниченного в пространстве, чтобы занимать только вершины решетки ( Дополнительный рисунок 1 ).Такие структуры могут быть эффективно минимизированы по энергии с помощью процесса Монте-Карло с цепью Маркова. Несмотря на их простоту, прошлые исследования показали, что решетчатые модели могут воспроизводить поведение сворачивания нативных белков. 19-23

Присоединение ДНК-меток к выбранным остаткам, необходимое для точного моделирования нашего подхода, ранее не было включено в модели решетки. Точное влияние ДНК-меток на структуру белка неясно. Однако мы обнаружили, что реализация с грубой степенью детализации, требуемой решетчатыми моделями, может быть построена на трех основных предположениях: теги предпочитают располагаться снаружи белка, требуют достаточного незанятого пространства, чтобы избежать стерических препятствий, и отталкивают друг друга, если расположены близко друг к другу. .В созданных таким образом решетчатых моделях значения FRET можно затем оценить по смоделированным положениям красителя. Чтобы смоделировать считывание эффективности FRET при заданном разрешении, мы используем значения эффективности, используя разрешение как ширину бина. Как мы показали в предыдущей работе, что разрешение в один процентный пункт FRET (0,01 E) является достижимым, мы установили разрешение отпечатков пальцев равным 0,01 E при моделировании, если не указано иное. Поскольку FRET X допускает ортогональное считывание нескольких типов остатков, выборку можно повторить для получения отпечатков FRET, связанных с различными типами остатков.По аналогии с экспериментально полученными отпечатками пальцев смоделированные отпечатки FRET для нескольких типов остатков затем объединяются, чтобы служить функциями для алгоритмов автоматической классификации.

Результаты

Экспериментальный фингерпринтинг модельных пептидов FRET X

Чтобы продемонстрировать концепцию фингерпринтинга белков с использованием FRET X и сравнить результаты с расчетными прогнозами, мы разработали анализ, в котором меченные ДНК пептиды иммобилизовались на поверхности ПЭГилированного кварца с помощью биотина. конъюгация стрептавидина (, фиг. 2A, ).Каждый пептид содержит N-концевой лизин для присоединения ДНК-стыковочной цепи, чтобы обеспечить временное связывание меченной акцептором (Cy5) цепи имидж-сканера. Кроме того, ортогональная ДНК-стыковочная цепь была конъюгирована с остатком цистеина в пептиде для облегчения временного связывания меченных донором (Cy3) цепей имидж-сканера (, фиг. 2A, ). Нити формирователя изображения донора и акцептора были разработаны для демонстрации времени пребывания ~ 2 с ( Дополнительный рисунок 2 ), так что красители можно часто пополнять.Кроме того, для увеличения вероятности присутствия акцепторной цепи формирователя изображения при связывании донорной цепи визуализатора и обеспечения возможности обнаружения FRET, мы вводили 10-кратный молярный избыток цепи акцепторного формирователя изображения над цепью донорского формирователя изображения. Короткоживущие события FRET регистрировали с помощью микроскопии полного внутреннего отражения одной молекулы после связывания как донорных, так и меченных акцептором цепей имидж-сканера с иммобилизованным целевым пептидом.

Рисунок 2

Модельные пептиды могут быть сняты с помощью FRET X. (A) Изображение экспериментальной системы для снятия пептидных отпечатков пальцев. Пептид-мишень иммобилизуют путем конъюгации его N-концевого биотина со стрептавидином на ПЭГилированной поверхности. Нить визуализатора, меченная донором (Cy3) (зеленая), может связываться с участком стыковки ДНК на цистеине, в то время как маркированная акцептором (Cy5) цепь визуализатора (красная) может гибридизоваться с участком стыковки на лизине. Одновременное связывание генерирует короткие события FRET и наблюдается с помощью микроскопии полного внутреннего отражения. (B) Типичный кимограф для пептида с цистеином, который находится на 10 аминокислотах, отделенных от акцепторного сайта связывания. Эффективность FRET для каждой точки данных в событии привязки (строки) и средняя эффективность FRET для всех точек данных в событии привязки (точки) указаны как функция времени. Распределение Гаусса (0,88 ± 0,05) аппроксимируется гистограммой средней эффективности FRET на событие FRET. Средние значения гауссианы нанесены на отдельную панель (внизу) и называются отпечатком пальца FRET пептида.Популяция FRET слева вызвана утечкой донора в акцепторный канал. (C) Наши четыре модельных пептида имеют лизин на N-конце и цистеин в положениях 10, 20, 30 или 40. (D) Экспериментальные распределения и отпечатки пальцев для каждого пептида показывают тенденцию к снижению FRET ( E ) для увеличения разделения пар FRET (0,89 ± 0,06, 0,75 ± 0,08, 0,72 ± 0,03, 0,57 ± 0,08). (E) Смоделированные распределения и отпечатки пальцев для четырех пептидов показывают аналогичную тенденцию к снижению. (F) Экспериментальные и смоделированные данные хорошо коррелируют. Стандартное отклонение экспериментальных точек данных составляет более четырех кимографов (каждый из сотен событий). Эксперименты проводились в отдельные дни.

Затем мы построили кимограф, чтобы визуализировать эффективность FRET каждого события связывания в целевом пептиде ( Рисунок 2B ). Рассчитываются эффективность FRET для каждой точки данных (, рисунок 2B, , линии) и средняя эффективность на событие связывания (, рисунок 2B, , кружки).Гистограмма средней эффективности FRET на событие связывания показывает различные популяции FRET. Распределения Гаусса были подобраны для разрешения центров пиков с высоким разрешением 14 , которые затем составляют отпечаток пептида ( Рисунок 2B , нижняя панель).

Чтобы продемонстрировать способность FRET X различать различные пептиды с различным разделением пар FRET, мы разработали четыре модельных пептида. Эти пептиды имели увеличивающееся расстояние с шагом в 10 аминокислот между донорной и акцепторной стыковочными цепями ( Рисунок 2C ).Во-первых, мы провели эксперименты с одной молекулой для получения экспериментальных отпечатков пальцев FRET и обнаружили четко различимый пик для каждого пептида ( Рисунок 2D и Дополнительный Рисунок 3 ). Затем мы смоделировали отпечатки FRET для тех же последовательностей с помощью нашего конвейера моделирования и обнаружили аналогичную тенденцию. Мы только точно настроили параметры эффекта отталкивания между тегами, чтобы минимизировать разницу с экспериментальными значениями (, рис. 2E, ). Как в моделировании, так и в экспериментах мы наблюдаем монотонное уменьшение эффективности FRET для увеличения разделения пар FRET.Кроме того, экспериментально полученные отпечатки пальцев обычно хорошо коррелируют со значениями, полученными при моделировании (, рис. 2F, ). Поскольку для каждого пептида минимальная межпептидная разница в FRET ( E ) больше, чем максимальное стандартное отклонение, мы обнаружили, что мы можем различить эти четыре пептида по их отпечатку FRET.

Моделирование сплайсоформ белков по отпечатку пальца

Мы решили оценить эффективность нашего метода целевой протеомики на основе моделирования.Для этого мы стремились идентифицировать различные сплайсоформы регулятора апоптоза Bcl-2 (UniProt ID: Q07817), которые являются потенциальными биомаркерами рака 23 и могут давать разные отпечатки пальцев. В то время как BCL-X L является антиапоптотическим регулятором, как BCL-X S , так и BCL-X b являются проапоптотическими факторами. 24,25 Соотношение между этими факторами важно для судьбы клетки. Мы смоделировали одновременное мечение цистеина (C) и лизина (K), чтобы создать отпечатки пальцев C + K для каждой из сплайсоформ, BCL-X L , BCL-X S и BCL-X B (рисунок ). 3A и B ).Поскольку сплайсоформы различаются по количеству и расположению остатков C и K, мы ожидали, что их отпечатки пальцев будут разными. Это действительно имело место при моделировании ( Рисунок 3C ). Отпечатки пальцев действительно различаются между отдельными молекулами одной и той же сплайсоформы; однако отпечатки пальцев остаются достаточно характерными, чтобы идентифицировать каждую форму сплайсинга на глаз ( Дополнительный рисунок 4A ). Мы также обучили и протестировали классификатор машины опорных векторов (SVM) на 10 повторах по 10-кратной схеме перекрестной проверки и достигли точности 100%.

Рисунок 3

Типичные отпечатки пальцев FRET ( E ) для трех форм сплайсоформ BCL-X. (A) Полностью атомарная структура для BCL XL, Xs и Xb (сверху вниз), предсказанная инструментом прогнозирования структуры RaptorX. (B) Энергетически оптимизированные структурные модели решетки с ДНК-стыковочными цепями, прикрепленными к цистеинам (оранжевый) и лизинам (фиолетовый). Эталонная стыковочная цепь акцептора (красная) добавляется к N-концу белков. (C) Смоделированный отпечаток пальца для сплайсоформы белков BCL.Отпечатки пальцев основаны на усредненных расстояниях донор-акцептор в 100 структурных снимках структур модели решетки, созданной цепью Маркова.

Затем мы смоделировали более сложный сценарий, в котором мы попытались классифицировать отпечатки пальцев для шести форм сплайсинга PTGS1 (идентификатор UniProt: P23219). 26 ).

Анализ смоделированных белковых смесей

Чтобы оценить тестовый пример, показывающий сложность, более близкую к той, что обнаружена в отдельной клетке, мы выбрали все записи протеома человека UniProt (ID: UP000005640), которые были связаны с одноцепочечной структурой в RCSB. база данных белков, для которой при моделировании решетки удалось найти конфигурацию без стерических затруднений стыковки цепей (n = 313). Основываясь на доступном химическом составе целевого мечения остатков и относительной частоте остатков в природных белках, мы смоделировали схемы мечения, включающие цистеин (C), лизин (K) и аргинин (R).Для каждого белка мы создали отпечатки пальцев на основе 10 отдельно смоделированных молекул, после чего мы обучили и протестировали классификатор SVM в 10-кратной схеме перекрестной проверки. Здесь мы указываем общую точность классификатора. Чтобы идентифицировать подмножество белков, для которых наш метод работает хорошо, мы также указываем количество хорошо идентифицируемых белков, то есть тех, для которых более 5 реплик были идентифицированы правильно.

Мы обнаружили, что наш классификатор работает с точностью 45% в отношении белков, меченных C.Из 313 белков 126 были хорошо идентифицированы, что указывает на то, что маркировки только C-остатков достаточно для последовательного распознавания этого подмножества белков (, рис. 4A, , оранжевый кружок). 57 белков не содержали остатков C, поэтому их невозможно идентифицировать с помощью C-мечения. Оставшиеся 130 плохо идентифицируемых белков обычно давали отпечатки пальцев, содержащие несколько значений FRET или сильно изменчивые отпечатки пальцев, причем последние указывали на отсутствие стабильности структуры.

Рис. 4 Результаты моделирования снятия отпечатков пальцев

FRET X при оптимальных и неоптимальных условиях эксперимента.Показатели эффективности перекрестной проверки классификатора отпечатков пальцев FRET X показаны для трех комбинаций типов помеченных остатков — C, C + K и C + K + R — и двух качеств маркировки — «оптимальное», когда все целевые остатки и нет остатков, не являющихся целевыми. были помечены как «субоптимальные», когда ошибочная маркировка произошла в соответствии с правилами, приведенными в дополнительной таблице 3. (A) Диаграмма Венна, показывающая количество белков, которые оказались хорошо идентифицируемыми, т. е. которые были правильно идентифицированы более чем в 5 из 10 вариантов перекрестной проверки.Общее количество белков 313. (B) Точность идентификации белков при оптимальных и субоптимальных условиях мечения. (C) Средняя точность классификатора как функция количества помеченных остатков в структурах, агрегированных в пять групп с одинаковым количеством тегов. Усы обозначают два стандартных отклонения.

Когда были помечены остатки C + K или C + K + R, точность повысилась до 82% и 95% соответственно ( Рисунок 4B ). Как и ожидалось, отпечатки пальцев с большей вероятностью получат характерную сигнатуру, если отслеживаются расстояния для большего количества типов остатков.Количество хорошо идентифицируемых отпечатков пальцев также выросло до 278 и 312 из 313 соответственно. Независимо от того, какие типы остатков помечены, мы обнаружили, что белки, содержащие больше меченых остатков, могут быть идентифицированы с более высокой точностью (рис. 4C) .

Устойчивость к субоптимальным экспериментальным условиям

Чтобы исследовать влияние ошибок маркировки, мы выполнили моделирование для неоптимального сценария маркировки с 90% вероятностью маркировки целевого остатка и определенной ненулевой вероятностью маркировки нецелевых остатков ( С: 1%, К: 1%, R: 0.5%, Дополнительная таблица 3 ). Для C и K эти вероятности были основаны на экспериментально определенных значениях эффективности и специфичности, найденных в литературе. 27-29

В целом мы обнаруживаем, что ошибки маркировки влекут за собой умеренное снижение производительности классификатора; для маркировки C, C + K и C + K + R точность снижается с 45%, 82% и 95% до 39%, 74% и 91% соответственно (рис. 4B). Это указывает на то, что отпечатки FRET — особенно те, которые получены при маркировке C + K + R — содержат избыточную информацию, необходимую для смягчения эффекта несовершенной маркировки (рис. 4C).Мы также исследовали влияние снижения разрешающей способности измерения, однако только после уменьшения разрешения, намного превышающего экспериментально достижимые уровни — за 0,10 E — мы обнаружили серьезное снижение точности (дополнительный рисунок 5).

Обсуждение

Здесь мы представляем новый подход к фингерпринтингу белков, который определяет расположение аминокислот в структуре белка с использованием FRET X. Мы предоставляем доказательства его способности идентифицировать белки в гетерогенных смесях с помощью моделирования и демонстрируем его техническую осуществимость, производя экспериментальные отпечатки пальцев для сконструированных пептидов.

Мы экспериментально демонстрируем дактилоскопию пептидов длиной 40 аминокислот и наблюдаем монотонное снижение эффективности FRET. Эта тенденция подтверждается моделированием и предполагает, что наша модель пептида имеет относительно линейную конформацию. Эти пептиды не исчерпывают нижний конец домена эффективности FRET, что означает, что более крупные пептиды и белки с увеличенным разделением пар FRET могут быть сняты по отпечаткам пальцев. Хотя большинство белков значительно больше, чем 40 аминокислот, они обычно имеют глобулярную структуру, которая уменьшает разделение пар FRET.Средний диаметр белка оценивается как 5 нм 30 , в то время как используемые здесь красители FRET (Cy3-Cy5) будут точными на расстояниях до ~ 7 нм. 1211 Таким образом, наш метод снятия отпечатков пальцев FRET может быть подходящим для идентификации большого набора белков человека. Это мнение подтверждается симуляциями с использованием нашей решеточной модели, которая показывает, что также для более крупных белков отпечатки FRET остаются различимыми.

Мы показываем, что смоделированные отпечатки пальцев достаточно уникальны и воспроизводимы, чтобы последовательно идентифицировать большинство белков в нашем пуле моделирования.Более того, этот результат может быть достигнут путем маркировки до трех типов аминокислот: цистеина, лизина и аргинина, все из которых могут быть нацелены на конкретную маркировку с использованием существующих химических методов. 4,27 Интересно, что даже если помечен только цистеин, мы обнаружили, что подмножество белков оставалось неизменно идентифицируемым, хотя маркировка дополнительных типов остатков действительно увеличивает точность, количество идентифицируемых белков и устойчивость к ошибкам маркировки. Следует также отметить, что набор типов остатков, нацеленных на снятие отпечатков пальцев FRET X, может быть расширен еще больше; маркировка e.грамм. метионин 31 или тирозин 32 могут быть использованы для дальнейшего повышения точности или адаптации нашего метода к обнаружению данного целевого белка. Для нашего моделирования мы исследовали белки, структура которых уже была определена; однако в нашей экспериментальной системе, микрофлюидной камере с нефизиологическими условиями, белки могут принимать другую структуру или набор из нескольких различных структур, создавая несоответствие между смоделированными и экспериментальными отпечатками пальцев.Однако для идентификации белка важны в первую очередь уникальность и воспроизводимость отпечатка пальца, а не обязательно его предсказуемость по известной структуре. Кроме того, мы ожидаем, что по мере того, как разнообразие образцов уменьшается с нескольких сотен до десятков различных белков за счет фракционирования образцов, уникальность отпечатков пальцев и, следовательно, доля правильно идентифицированных белков резко возрастает. Следовательно, для более целенаправленных подходов важна надлежащая подготовка и очистка образцов для уменьшения сложности образцов.

Далеко идущая цель протеомного сообщества — обнаружить и проанализировать все протеоформы, которые могут быть получены из одного гена, кодирующего белок. 2 Большинство протеоформ имеют небольшие различия, например альтернативный сплайсинг или посттрансляционная модификация, которые трудно обнаружить с помощью современных технологий, таких как ELISA, MS или нативный MS. 33 Мы показали, что FRET X обладает способностью различать пептиды на основе местоположения одного цистеина, тонкость, аналогичная той, которая обнаруживается во многих изоформах, и мы показали два случая, в которых клинически значимые сплайсоформы хорошо различимы на основе их смоделированные отпечатки пальцев FRET X.Это говорит о том, что наша платформа для снятия отпечатков пальцев FRET X будет подходящим дополнительным методом для обнаружения клинически значимых протеоформ.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *